Path 03 · 17 Lessons · 2 Modules

Bioinformatics Core

Comprehensive instruction in Biopython's core sequence and record object models, coupled with practical handling of biological file formats including FASTA, FASTQ, GenBank, and GFF. Special emphasis is placed on coordinate transformations and alignment interpretation.

Start PathEnter

By the End

Parse and write standard biological sequence file formats including FASTA, FASTQ, and GenBank
Manipulate Seq, SeqRecord, and SeqFeature objects while preserving biological metadata
Execute, parameterize, and interpret global and local pairwise sequence alignments

Progress

0/17

FASTA Sequence Header and RecordReference transcript sequence (sample.fasta)

>NM_000546.6 TP53 transcript variant 1 (excerpt)
ATGGAGGAGCCGCAGTCAGATCCTAGCGTCGAGCCCCCTCTGAGTCAGGAAACATTTTCA
GACCTATGGAAACTACTTCCTGAAAACAACGTTCTGTCCCCCTTGCCGTCCCAAGCAATG

Genomics Basics

Molecular biology fundamentals translated into computational representations, including transcription, translation, and standard variant formatting.

2 lessons · 2 graded

DNA to mRNA: Transcription3 Reading Variants: HGVS Format Validation3Intermediate

Biopython

Computational biology workflows for manipulating biological sequences, sequence records, structural models, alignments, and standard bioinformatics file formats.

15 lessons · 15 graded

AlignIO4 Bio.Blast3 Bio.Entrez3 Bio.PDB4 Bio.Phylo4 Bio.Restriction4 Bio.SeqUtils4 Bio.motifs4 Biopython Deprecations4 PairwiseAligner4 Seq4 SeqFeature and Location4 SeqIO4 SeqRecord4 Substitution Matrices4

Next PathClinical Variants